| Detail of EST/Unigene BF639851 |
| Acc. | BF639851 |
| Internal Acc. | NF016E06IN1F1051 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=2e-15; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=3e-13; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-11; Lipoxygenase 7, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-10; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-07; |
| Length | 548 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTCCCTCTTCTCATTCCTCAATTATTATTTATAGTATAAATCTTAGTGCATTATCTTAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838314 |
| Trichome-related Gene from Literature | N/A |