Detail of EST/Unigene BF639873 |
Acc. | BF639873 |
Internal Acc. | NF019H12IN1F1104 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=6e-66; Light-induced protein, chloroplastic OS=Solanum demissum E-value=2e-65; Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=9e-64; Probable plastid-lipid-associated protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-62; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=3e-62; |
Length | 694 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TTTTTGGTTATAAAACTAAATTTTTTTATATCTAAAATGGTGACAATTATTTTGTATAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825714 |
Trichome-related Gene from Literature | N/A |