| Detail of EST/Unigene BF639924 |
| Acc. | BF639924 |
| Internal Acc. | NF027G01IN1F1006 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--nitrite reductase, chloroplastic OS=Betula pendula E-value=3e-63; Ferredoxin--nitrite reductase, chloroplastic OS=Spinacia oleracea E-value=1e-60; Ferredoxin--nitrite reductase, chloroplastic (Fragment) OS=Zea mays E-value=1e-57; Ferredoxin--nitrite reductase, chloroplastic OS=Arabidopsis thaliana E-value=3e-57; Ferredoxin--nitrite reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-55; |
| Length | 511 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CACACACTCTCTTCTCCAAAAATGTCTTCCTTCTCAGTACGTTTCCTCACTCCACCATCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816055 |
| Trichome-related Gene from Literature | N/A |