| Detail of EST/Unigene BF640032 |
| Acc. | BF640032 |
| Internal Acc. | NF034D01IN1F1012 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Solanum tuberosum E-value=1e-15; Transketolase, chloroplastic OS=Spinacia oleracea E-value=1e-14; Transketolase, chloroplastic OS=Zea mays E-value=5e-14; Transketolase 7 OS=Craterostigma plantagineum E-value=3e-12; Transketolase 10 OS=Craterostigma plantagineum E-value=6e-11; |
| Length | 190 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CACCTACCTCCCGTCGCAGAACCACACCAGCCATCCGCGCCACCGCTGTTGAAACACTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825246 |
| Trichome-related Gene from Literature | N/A |