Detail of EST/Unigene BF640032 |
Acc. | BF640032 |
Internal Acc. | NF034D01IN1F1012 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Solanum tuberosum E-value=1e-15; Transketolase, chloroplastic OS=Spinacia oleracea E-value=1e-14; Transketolase, chloroplastic OS=Zea mays E-value=5e-14; Transketolase 7 OS=Craterostigma plantagineum E-value=3e-12; Transketolase 10 OS=Craterostigma plantagineum E-value=6e-11; |
Length | 190 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CACCTACCTCCCGTCGCAGAACCACACCAGCCATCCGCGCCACCGCTGTTGAAACACTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825246 |
Trichome-related Gene from Literature | N/A |