Detail of EST/Unigene BF640122 |
Acc. | BF640122 |
Internal Acc. | NF037F05IN1F1046 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=4e-55; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=7e-50; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-34; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-34; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-34; |
Length | 385 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GCTCAGCAGCTGTTGTTAAACAAACCATCTTTCCTTGGTCAAAGGAAGGGTGCTGCCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |