Detail of EST/Unigene BF640132 |
Acc. | BF640132 |
Internal Acc. | NF037G11IN1F1087 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | BTB/POZ and TAZ domain-containing protein 1 OS=Arabidopsis thaliana E-value=1e-46; BTB/POZ and TAZ domain-containing protein 2 OS=Arabidopsis thaliana E-value=2e-45; BTB/POZ and TAZ domain-containing protein 4 OS=Arabidopsis thaliana E-value=4e-34; BTB/POZ and TAZ domain-containing protein 5 OS=Arabidopsis thaliana E-value=2e-27; BTB/POZ and TAZ domain-containing protein 3 OS=Arabidopsis thaliana E-value=3e-25; |
Length | 585 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GCGAAACGAGGAGAGAGAACTCGAGGAAGCATAGGGAGGAGCAAGGGTTGTATGCGGAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04498 E1A/CREB-binding protein; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04498 E1A/CREB-binding protein |
EC | 2.3.1.48 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836437 |
Trichome-related Gene from Literature | N/A |