| Detail of EST/Unigene BF640137 |
| Acc. | BF640137 |
| Internal Acc. | NF027A10IN1F1072 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Pisum sativum E-value=1e-75; Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Nicotiana tabacum E-value=1e-41; Aldolases N-methyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=1e-35; |
| Length | 475 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATCTTTTCTGGAGGTTCAGTTTCACTCTTCCCTTTTCACACAAACAAGGGTACATCATCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837964 |
| Trichome-related Gene from Literature | N/A |