| Detail of EST/Unigene BF640300 |
| Acc. | BF640300 |
| Internal Acc. | NF035E10IN1F1082 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Pisum sativum E-value=7e-19; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Arabidopsis thaliana E-value=9e-10; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=2e-09; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Spinacia oleracea E-value=1e-08; |
| Length | 246 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTCTATACTCCAACTTCTTCTTCCTTGTAGGCTTAATCATGGCTTCGGCTACTTTCTCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822277 |
| Trichome-related Gene from Literature | N/A |