Detail of EST/Unigene BF640300 |
Acc. | BF640300 |
Internal Acc. | NF035E10IN1F1082 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Pisum sativum E-value=7e-19; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Arabidopsis thaliana E-value=9e-10; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=2e-09; Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic OS=Spinacia oleracea E-value=1e-08; |
Length | 246 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCTATACTCCAACTTCTTCTTCCTTGTAGGCTTAATCATGGCTTCGGCTACTTTCTCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822277 |
Trichome-related Gene from Literature | N/A |