Detail of EST/Unigene BF640338 |
Acc. | BF640338 |
Internal Acc. | NF031D08IN1F1073 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=1e-12; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=7e-10; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-08; Lipoxygenase 7, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-06; |
Length | 537 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | ATAACTTCTCTCCCTCTTCTCATTCCTCAATTATTATTTATAGTATAAATCTTAGTGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838314 |
Trichome-related Gene from Literature | N/A |