Detail of EST/Unigene BF640359 |
Acc. | BF640359 |
Internal Acc. | NF037F01IN1F1013 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=3e-24; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=1e-22; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-21; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=6e-21; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. japonica E-value=3e-17; |
Length | 507 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TTCATTTCTTCTCACACTTTCCACCATCATCAATTTCCATCAGCTCTTTTCTATTTCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |