| Detail of EST/Unigene BF640359 |
| Acc. | BF640359 |
| Internal Acc. | NF037F01IN1F1013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=3e-24; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=1e-22; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-21; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=6e-21; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. japonica E-value=3e-17; |
| Length | 507 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TTCATTTCTTCTCACACTTTCCACCATCATCAATTTCCATCAGCTCTTTTCTATTTCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827061 |
| Trichome-related Gene from Literature | 827061 |