| Detail of EST/Unigene BF640622 |
| Acc. | BF640622 |
| Internal Acc. | NF032A02IN1F1008 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable alanine--tRNA ligase, chloroplastic OS=Populus trichocarpa E-value=1e-10; Probable alanine--tRNA ligase, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Probable alanine--tRNA ligase, chloroplastic OS=Sorghum bicolor E-value=4e-10; Probable alanine--tRNA ligase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-09; Probable alanine--tRNA ligase, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-09; |
| Length | 411 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | GTGGCAACTGGCAGTAAGGAGGGAAATCTGTTGAGTGAGAAAGGAAGAAGAAGAAGATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832343 |
| Trichome-related Gene from Literature | N/A |