Detail of EST/Unigene BF640653 |
Acc. | BF640653 |
Internal Acc. | NF035A07IN1F1052 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-40; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=2e-37; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-36; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=5e-35; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=1e-34; |
Length | 360 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | ATTTATCAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |