| Detail of EST/Unigene BF640653 |
| Acc. | BF640653 |
| Internal Acc. | NF035A07IN1F1052 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-40; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=2e-37; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=3e-36; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=5e-35; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=1e-34; |
| Length | 360 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATTTATCAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |