Detail of EST/Unigene BF640823 |
Acc. | BF640823 |
Internal Acc. | NF057E02IN1F1018 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=5e-29; Cytochrome P450 71A1 OS=Persea americana E-value=7e-29; Cytochrome P450 71B2 OS=Arabidopsis thaliana E-value=6e-28; Cytochrome P450 71D8 OS=Glycine max E-value=1e-27; Cytochrome P450 71B16 OS=Arabidopsis thaliana E-value=2e-27; |
Length | 526 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); |
Sequence | TAGACATGTCTTTTGCAGTAACAACAATAATATTTGCTTTTCTTCTCTTCACTTTCATGT |
EST members of Unigene | BF640823 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07420 cytochrome P450, family 2, subfamily S |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39134.1.S1_at
|
Corresponding NCBI Gene | 837865 |
Trichome-related Gene from Literature | N/A |