Detail of EST/Unigene BF640907 |
Acc. | BF640907 |
Internal Acc. | NF037B02IN1F1016 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=5e-13; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=5e-13; 30 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=7e-12; |
Length | 340 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCTCTTCACCAAAAACTCCCCTCAATGTTTCTCTTCACTCCCTTCTCTTTCCCTCAACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824514 |
Trichome-related Gene from Literature | N/A |