Detail of EST/Unigene BF640963 |
Acc. | BF640963 |
Internal Acc. | NF041C06IN1F1049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-2, chloroplastic OS=Vigna unguiculata E-value=7e-23; Ferritin-4, chloroplastic OS=Glycine max E-value=8e-21; Ferritin-2, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; Ferritin-3, chloroplastic OS=Glycine max E-value=3e-17; Ferritin-2, chloroplastic OS=Nicotiana tabacum E-value=6e-17; |
Length | 371 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | ACCAAATCCAACATTTTCAGTTTCATTTCCCTCTGAATTTTCCTTTCTCTCCATTTTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820276 |
Trichome-related Gene from Literature | N/A |