| Detail of EST/Unigene BF641167 |
| Acc. | BF641167 |
| Internal Acc. | NF061E09IN1F1070 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein OS=Arabidopsis thaliana E-value=6e-72; cAMP-dependent protein kinase catalytic subunit OS=Dictyostelium discoideum E-value=3e-26; cAMP-dependent protein kinase catalytic subunit alpha OS=Mus musculus E-value=3e-25; cAMP-dependent protein kinase catalytic subunit PRKX OS=Mus musculus E-value=3e-25; cAMP-dependent protein kinase catalytic subunit PRKX OS=Homo sapiens E-value=3e-25; |
| Length | 668 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CTGAGATTGGACTTGCAAATTTAAAAGACTCAGAAAATGTGCTTACTTTGAAGAAATTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04345 protein kinase A; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K04345 protein kinase A; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04345 protein kinase A; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04345 protein kinase A |
| EC | 2.7.11.11 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816524 |
| Trichome-related Gene from Literature | N/A |