Detail of EST/Unigene BF641314 |
Acc. | BF641314 |
Internal Acc. | NF064C07IN1F1053 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=4e-35; Oxygen-evolving enhancer protein 3, chloroplastic OS=Onobrychis viciifolia E-value=6e-35; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-34; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=1e-32; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=1e-31; |
Length | 513 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GACAGTTGTTAGAGCACAACAGCAACAGGAAAGTAGCAGAAGAGCAGTGATTGGTCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825866 |
Trichome-related Gene from Literature | N/A |