Detail of EST/Unigene BF641321 |
Acc. | BF641321 |
Internal Acc. | NF059F12IN1F1102 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=3e-12; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=2e-09; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-08; Lipoxygenase 7, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-07; |
Length | 514 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TTCTCATTCCTCAATTATTATTTATAGTATAAATCTTAGTGCATTATCTTAAAATATAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838314 |
Trichome-related Gene from Literature | N/A |