Detail of EST/Unigene BF641371 |
Acc. | BF641371 |
Internal Acc. | NF065G11IN1F1087 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-18; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=7e-18; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=1e-17; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=2e-17; 29 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=7e-17; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GAGAAGAGAACTAGTCTCGAGTTTTACACCATTCACCACTACCATCACAACAACATGGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.2.1.8 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |