Detail of EST/Unigene BF641381 |
Acc. | BF641381 |
Internal Acc. | NF061G05IN1F1039 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=1e-27; 29 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=2e-27; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=8e-27; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-26; 30 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-26; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTCACTCTCTTCTTCAATAAACCCTAATTTCCTCATTCTCTCAAAACCTTATCCATTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818299 |
Trichome-related Gene from Literature | N/A |