| Detail of EST/Unigene BF641432 |
| Acc. | BF641432 |
| Internal Acc. | NF064H11IN1F1095 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase OS=Glycine max E-value=0; Linoleate 9S-lipoxygenase 1 OS=Phaseolus vulgaris E-value=0; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=0; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=0; Seed linoleate 13S-lipoxygenase-1 OS=Glycine max E-value=5e-98; |
| Length | 650 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | ATTGGTTGAATACTCATGCAGTTGTTGAACCATTCATCATAGCAACAAATAGGCATCTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
| EC | 1.13.11.- 1.13.11.34 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841944 |
| Trichome-related Gene from Literature | 841944 |