| Detail of EST/Unigene BF641531 |
| Acc. | BF641531 |
| Internal Acc. | NF062B06IN1F1048 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aminomethyltransferase, mitochondrial OS=Pisum sativum E-value=3e-67; Aminomethyltransferase, mitochondrial OS=Flaveria pringlei E-value=4e-61; Aminomethyltransferase, mitochondrial OS=Flaveria anomala E-value=4e-61; Aminomethyltransferase, mitochondrial OS=Flaveria trinervia E-value=1e-60; Aminomethyltransferase, mitochondrial OS=Solanum tuberosum E-value=1e-59; |
| Length | 491 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | GCCTTGTACTTGATGTGAGAAACATAATAATGACATTAACCTTTATGTAATGTAACNTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K00605 aminomethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00605 aminomethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00605 aminomethyltransferase |
| EC | 2.1.2.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837733 |
| Trichome-related Gene from Literature | N/A |