| Detail of EST/Unigene BF641534 |
| Acc. | BF641534 |
| Internal Acc. | NF062G01IN1F1006 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-amylase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-29; Beta-amylase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-15; Inactive beta-amylase 4, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; Beta-amylase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; Beta-amylase OS=Vigna unguiculata E-value=2e-08; |
| Length | 382 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CGTTCTTCAATTTCTTTCATCATTCAGAAAGAAACCAAGTTCCTTAAAACCTTTGATGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827419 |
| Trichome-related Gene from Literature | N/A |