Detail of EST/Unigene BF641534 |
Acc. | BF641534 |
Internal Acc. | NF062G01IN1F1006 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-amylase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-29; Beta-amylase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-15; Inactive beta-amylase 4, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; Beta-amylase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; Beta-amylase OS=Vigna unguiculata E-value=2e-08; |
Length | 382 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CGTTCTTCAATTTCTTTCATCATTCAGAAAGAAACCAAGTTCCTTAAAACCTTTGATGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827419 |
Trichome-related Gene from Literature | N/A |