Detail of EST/Unigene BF641647 |
Acc. | BF641647 |
Internal Acc. | NF051D07IN1F1061 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-10; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=5e-10; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=2e-09; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=8e-09; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-08; |
Length | 681 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTACCACCAATGGCAACGTTAGAATCAACCTTAACTGTATTCACACATCAACGTTTCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818107 |
Trichome-related Gene from Literature | N/A |