Detail of EST/Unigene BF642171 |
Acc. | BF642171 |
Internal Acc. | NF019A08IN1F1065 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=2e-39; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=6e-18; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=3e-16; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=3e-16; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=4e-16; |
Length | 486 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CATCAAAGCTTAGTTTGAGTTGAAGATTCCTAAAACCAACCATGGCTTCCATTGCTGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |