Detail of EST/Unigene BF642273 |
Acc. | BF642273 |
Internal Acc. | NF050G01IN1F1006 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=0; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=0; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=0; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CAAAACTATTTCTTTCCACCCTCTTTCTTTCTCTCTCATTTCCATCAATGGCAGATCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834828 |
Trichome-related Gene from Literature | N/A |