| Detail of EST/Unigene BF642570 |
| Acc. | BF642570 |
| Internal Acc. | NF070G05IN1F1039 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protease Do-like 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-88; Protease Do-like 9 OS=Arabidopsis thaliana E-value=8e-58; Protease Do-like 4, mitochondrial OS=Arabidopsis thaliana E-value=9e-43; Putative protease Do-like 3, mitochondrial OS=Arabidopsis thaliana E-value=1e-40; Protease Do-like 10, mitochondrial OS=Arabidopsis thaliana E-value=9e-40; |
| Length | 607 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CAATTCACAAGCACTGGAAGTGCGTTTATGATTGGAGGCAAGAAACTATTAACCAACGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.4.21.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819406 |
| Trichome-related Gene from Literature | N/A |