Detail of EST/Unigene BF642570 |
Acc. | BF642570 |
Internal Acc. | NF070G05IN1F1039 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protease Do-like 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-88; Protease Do-like 9 OS=Arabidopsis thaliana E-value=8e-58; Protease Do-like 4, mitochondrial OS=Arabidopsis thaliana E-value=9e-43; Putative protease Do-like 3, mitochondrial OS=Arabidopsis thaliana E-value=1e-40; Protease Do-like 10, mitochondrial OS=Arabidopsis thaliana E-value=9e-40; |
Length | 607 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CAATTCACAAGCACTGGAAGTGCGTTTATGATTGGAGGCAAGAAACTATTAACCAACGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.21.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819406 |
Trichome-related Gene from Literature | N/A |