Detail of EST/Unigene BF642573 |
Acc. | BF642573 |
Internal Acc. | NF060G02IN1F1018 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=2e-31; Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=3e-26; Phospholipase A(1) DAD1, chloroplastic OS=Arabidopsis thaliana E-value=3e-15; Phospholipase A1-IIalpha OS=Arabidopsis thaliana E-value=6e-15; |
Length | 533 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | AAGACGCCAGCCTCCAGACTCCATATCTTCATTCTCACTCCAACATGGCTGCATCAATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817604 |
Trichome-related Gene from Literature | N/A |