| Detail of EST/Unigene BF642573 |
| Acc. | BF642573 |
| Internal Acc. | NF060G02IN1F1018 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=2e-31; Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=3e-26; Phospholipase A(1) DAD1, chloroplastic OS=Arabidopsis thaliana E-value=3e-15; Phospholipase A1-IIalpha OS=Arabidopsis thaliana E-value=6e-15; |
| Length | 533 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | AAGACGCCAGCCTCCAGACTCCATATCTTCATTCTCACTCCAACATGGCTGCATCAATCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817604 |
| Trichome-related Gene from Literature | N/A |