Detail of EST/Unigene BF642580 |
Acc. | BF642580 |
Internal Acc. | NF060H09IN1F1078 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=5e-61; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-54; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-53; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=6e-53; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-51; |
Length | 569 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTTATCCAAAACCAAATCCTCTTAAACCCTAGCCACCATTTTCTCCCAATTCCACACTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835751 |
Trichome-related Gene from Literature | N/A |