Detail of EST/Unigene BF642732 |
Acc. | BF642732 |
Internal Acc. | NF070F12IN1F1102 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=1e-94; Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=1e-89; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=6e-22; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=1e-21; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=4e-20; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GGGAAAAACATGGCTACACAAGCTCTAGTGTCGTCATCATCTCTTACTTTTGCAGCTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842446 |
Trichome-related Gene from Literature | N/A |