| Detail of EST/Unigene BF642749 |
| Acc. | BF642749 |
| Internal Acc. | NF072A04IN1F1024 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable phytol kinase 1, chloroplastic OS=Glycine max E-value=1e-52; Phytol kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-34; Probable phytol kinase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-28; Probable phytol kinase, chloroplastic OS=Zea mays E-value=1e-27; Probable phytol kinase 2, chloroplastic OS=Glycine max E-value=2e-20; |
| Length | 557 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TTCAGACATGACTCTCTTATCCTCTCACCTCTTTCCATTCTCCTCCGTGCACTGCCGCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830328 |
| Trichome-related Gene from Literature | N/A |