Detail of EST/Unigene BF642749 |
Acc. | BF642749 |
Internal Acc. | NF072A04IN1F1024 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable phytol kinase 1, chloroplastic OS=Glycine max E-value=1e-52; Phytol kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-34; Probable phytol kinase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-28; Probable phytol kinase, chloroplastic OS=Zea mays E-value=1e-27; Probable phytol kinase 2, chloroplastic OS=Glycine max E-value=2e-20; |
Length | 557 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | TTCAGACATGACTCTCTTATCCTCTCACCTCTTTCCATTCTCCTCCGTGCACTGCCGCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830328 |
Trichome-related Gene from Literature | N/A |