Detail of EST/Unigene BF643235 |
Acc. | BF643235 |
Internal Acc. | NF002E03EC1F1020 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=1e-29; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=2e-29; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=3e-29; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=3e-29; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=3e-29; |
Length | 412 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | AGAGAAAGAAAACAAGAGAACACAATCATAGTGATTTGTTGGCAAAGATTTGTTTAACGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824293 |
Trichome-related Gene from Literature | N/A |