Detail of EST/Unigene BF643273 |
Acc. | BF643273 |
Internal Acc. | NF003H12EC1F1101 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=4e-76; Probable glutathione S-transferase MSR-1 OS=Nicotiana plumbaginifolia E-value=1e-69; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=1e-69; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=3e-69; Glutathione S-transferase U20 OS=Arabidopsis thaliana E-value=8e-69; |
Length | 690 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | AGTCAATACATGGATAAGGACAGTGTGGTTTTGTTGGATTTTTGGCCAAGCGTATATGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 838289 |
Trichome-related Gene from Literature | N/A |