Detail of EST/Unigene BF643290 |
Acc. | BF643290 |
Internal Acc. | NF005G05EC1F1037 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable phytol kinase 3, chloroplastic OS=Glycine max E-value=5e-61; Probable phytol kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-44; Probable phytol kinase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-41; Probable phytol kinase 1, chloroplastic OS=Glycine max E-value=1e-24; Probable phytol kinase, chloroplastic OS=Triticum aestivum E-value=6e-24; |
Length | 579 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CAACAACATTAAATTTGACTCAATTCCCTCTGTTTCATCTCTCCCTCTTCTCCTCACACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835969 |
Trichome-related Gene from Literature | N/A |