| Detail of EST/Unigene BF643404 |
| Acc. | BF643404 |
| Internal Acc. | NF007G07EC1F1053 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Swertia mussotii E-value=7e-31; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=5e-29; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=7e-26; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=1e-25; Cytochrome P450 93A3 OS=Glycine max E-value=2e-24; |
| Length | 414 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GTCGTACATCTGTTTATGCTGGCAAGATCCTTGATATCTTCGAACGTTTGGTTGATCAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00488 cytochrome P450, family 27, subfamily A (cholestanetriol 26-monooxygenase); Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, famil |
| EC | 1.14.13.98 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840263 |
| Trichome-related Gene from Literature | N/A |