| Detail of EST/Unigene BF643433 |
| Acc. | BF643433 |
| Internal Acc. | NF003G01EC1F1005 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=2e-78; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=2e-39; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=1e-37; Cytochrome P450 750A1 OS=Pinus taeda E-value=1e-26; Cytochrome P450 71B22 OS=Arabidopsis thaliana E-value=2e-23; |
| Length | 667 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | CACTAACTCATTCTCCAAATAACAATTTAAGGTAGCCAAAACCAAATTAATTAGTAATTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07412 cytochrome P450, family 2, subfamily B; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07412 cytochrome P450, family 2, subfamily B; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07412 cytochrome P450, family 2, subfamily B; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07412 cytochrome P450, family 2, subfamily B |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816851 |
| Trichome-related Gene from Literature | N/A |