Detail of EST/Unigene BF643740 |
Acc. | BF643740 |
Internal Acc. | NF089D10EC1F1090 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A8 OS=Mentha piperita E-value=2e-31; Cytochrome P450 71A14 OS=Arabidopsis thaliana E-value=4e-31; Cytochrome P450 71A16 OS=Arabidopsis thaliana E-value=2e-29; Cytochrome P450 71A25 OS=Arabidopsis thaliana E-value=3e-29; Cytochrome P450 71A26 OS=Arabidopsis thaliana E-value=5e-29; |
Length | 507 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | AAACGTAACTATTCAAATTGAAATGTATTATTTAGCTCACGTAGGCGTGAATCCATACAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1 |
EC | 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832566 |
Trichome-related Gene from Literature | N/A |