Detail of EST/Unigene BF643864 |
Acc. | BF643864 |
Internal Acc. | NF089C08EC1F1066 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Solanum tuberosum E-value=1e-45; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=2e-43; Transketolase, chloroplastic OS=Spinacia oleracea E-value=1e-41; Transketolase, chloroplastic OS=Zea mays E-value=1e-39; Transketolase 10 OS=Craterostigma plantagineum E-value=8e-39; |
Length | 384 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GTTGATGCCACAAGAAACAATCTTGGATGGCCATATGAGCCTTTCCACGTGCCCGAGGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |