Detail of EST/Unigene BF644027 |
Acc. | BF644027 |
Internal Acc. | NF008G09EC1F1072 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=5e-44; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=6e-41; Probable beta-1,3-galactosyltransferase 4 OS=Arabidopsis thaliana E-value=4e-35; Probable beta-1,3-galactosyltransferase 1 OS=Arabidopsis thaliana E-value=1e-22; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=6e-11; |
Length | 578 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CTTTGAAATAATAACCTCTTTTTTCATTAAATTAAACCCAGTGTTTTTTCATATTCAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839292 |
Trichome-related Gene from Literature | N/A |