Detail of EST/Unigene BF644598 |
Acc. | BF644598 |
Internal Acc. | NF016C07EC1F1053 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Salvelinus fontinalis E-value=2e-49; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Mus musculus E-value=5e-47; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Homo sapiens E-value=9e-47; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Rattus norvegicus E-value=4e-46; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Bos taurus E-value=7e-46; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GCCGTCTGTACGTAGTAATCTCGTCCTCGCGCCGTCGTTTCTGTGCCGCCGCTCTTTGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.18.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829370 |
Trichome-related Gene from Literature | N/A |