| Detail of EST/Unigene BF644985 |
| Acc. | BF644985 |
| Internal Acc. | NF031B10EC1F1080 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | O-succinylhomoserine sulfhydrylase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=6e-13; O-succinylhomoserine sulfhydrylase OS=Mycobacterium tuberculosis E-value=4e-11; Cystathionine gamma-lyase OS=Bacillus subtilis (strain 168) E-value=2e-10; O-acetylhomoserine (thiol)-lyase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-09; Cystathionine beta-lyase metC OS=Bacillus subtilis (strain 168) E-value=1e-08; |
| Length | 658 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GATACATAGTACATACTTATTTGTTTAACTTCATTTTCAACATCATAGTACAACTTTCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01758 cystathionine gamma-lyase |
| EC | 4.4.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842774 |
| Trichome-related Gene from Literature | N/A |