Detail of EST/Unigene BF645112 |
Acc. | BF645112 |
Internal Acc. | NF028G07EC1F1055 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=0; Alternative oxidase 1b, mitochondrial OS=Arabidopsis thaliana E-value=2e-97; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=4e-97; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=6e-97; Alternative oxidase 1, mitochondrial OS=Glycine max E-value=1e-95; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CACAAAACCAGATGGTACTGAATGGAAATGGAATTGCTTCAGGCCATGGGAGACATACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821806 |
Trichome-related Gene from Literature | N/A |