| Detail of EST/Unigene BF645284 |
| Acc. | BF645284 |
| Internal Acc. | NF036A12EC1F1088 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=6e-51; Cytochrome P450 71B23 OS=Arabidopsis thaliana E-value=6e-51; Cytochrome P450 71B20 OS=Arabidopsis thaliana E-value=1e-50; Cytochrome P450 71B19 OS=Arabidopsis thaliana E-value=2e-50; Cytochrome P450 71B4 OS=Arabidopsis thaliana E-value=3e-50; |
| Length | 655 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GATGAACTTTATCAAAGTATTGTTGATGAACATCTTGATCCAGAAAGGAAGAAGTTGCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829277 |
| Trichome-related Gene from Literature | N/A |