Detail of EST/Unigene BF645284 |
Acc. | BF645284 |
Internal Acc. | NF036A12EC1F1088 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=6e-51; Cytochrome P450 71B23 OS=Arabidopsis thaliana E-value=6e-51; Cytochrome P450 71B20 OS=Arabidopsis thaliana E-value=1e-50; Cytochrome P450 71B19 OS=Arabidopsis thaliana E-value=2e-50; Cytochrome P450 71B4 OS=Arabidopsis thaliana E-value=3e-50; |
Length | 655 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GATGAACTTTATCAAAGTATTGTTGATGAACATCTTGATCCAGAAAGGAAGAAGTTGCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829277 |
Trichome-related Gene from Literature | N/A |