Detail of EST/Unigene BF645593 |
Acc. | BF645593 |
Internal Acc. | NF016H02EC1F1027 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-phosphate 3-epimerase, cytoplasmic isoform OS=Oryza sativa subsp. japonica E-value=4e-86; Ribulose-phosphate 3-epimerase OS=Homo sapiens E-value=3e-50; Ribulose-phosphate 3-epimerase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=7e-50; Ribulose-phosphate 3-epimerase OS=Pongo abelii E-value=1e-49; Ribulose-phosphate 3-epimerase OS=Mus musculus E-value=2e-49; |
Length | 683 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GCAAACATATTTACAAACCGACCAATACCGAATCGTGAATACCTTCTTTGCTTCGTGTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K01783 ribulose-phosphate 3-epimerase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01783 ribulose-phosphate 3-epimerase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01783 ribulose-phosphate 3-epimerase |
EC | 5.1.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842635 |
Trichome-related Gene from Literature | N/A |