| Detail of EST/Unigene BF645746 |
| Acc. | BF645746 |
| Internal Acc. | NF034H03EC1F1031 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=1e-50; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=2e-35; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-33; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=2e-32; |
| Length | 438 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | CAAAAATGGCGGCCGTAACTTCCTCATGCTCCACCGCGATCTCCGCCTCTTCCAAAACCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825030 |
| Trichome-related Gene from Literature | N/A |