| Detail of EST/Unigene BF645845 |
| Acc. | BF645845 |
| Internal Acc. | NF032F07EC1F1062 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase CTR1 OS=Arabidopsis thaliana E-value=5e-11; Ankyrin-3 OS=Homo sapiens E-value=1e-09; Probable serine/threonine-protein kinase DDB_G0271538 OS=Dictyostelium discoideum E-value=6e-09; Protein TANC1 OS=Rattus norvegicus E-value=6e-09; Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit A OS=Mus musculus E-value=6e-09; |
| Length | 591 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GGATTTGCTTAACGAAGGAATTGATGTTAATAGCATTGATCTTGATGGCCGTACTGCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01425 glutaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01425 glutaminase; Metabolism > Metabolism of Other Amino Acids > ko00471 D-Glutamine and D-glutamate metabolism > K01425 glutaminase |
| EC | 3.5.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC |
| Probeset |
|
| Corresponding NCBI Gene | 817737 |
| Trichome-related Gene from Literature | N/A |