| Detail of EST/Unigene BF645970 |
| Acc. | BF645970 |
| Internal Acc. | NF043D03EC1F1029 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Brassica juncea E-value=3e-78; Cysteine synthase OS=Citrullus lanatus E-value=6e-78; Cysteine synthase OS=Brassica juncea E-value=6e-78; Cysteine synthase OS=Spinacia oleracea E-value=1e-77; Cysteine synthase OS=Arabidopsis thaliana E-value=4e-77; |
| Length | 523 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | AAAGGTCTGGAATTGCTAAAGATGTTACAGAATTGATTGGCAAAACCCCGTTAGTGTATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827145 |
| Trichome-related Gene from Literature | 827145 |