| Detail of EST/Unigene BF645986 |
| Acc. | BF645986 |
| Internal Acc. | NF043H02EC1F1027 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=4e-83; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=9e-51; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=2e-49; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=3e-46; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=3e-46; |
| Length | 608 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GCTACAATGGCTACAAATCAGGAAGAAGTGAAGCTATTGGGAGCGATAGGAAGCCCATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |