Detail of EST/Unigene BF646579 |
Acc. | BF646579 |
Internal Acc. | NF077F11EC1F1094 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=9e-97; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=7e-83; Lichenase OS=Nicotiana plumbaginifolia E-value=8e-66; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=2e-65; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=9e-63; |
Length | 646 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GTAGGGCAAATCCTTCTTTCATATTCATTTTTAGTGTATACTTTATTTTGCATCATACCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |