Detail of EST/Unigene BF646730 |
Acc. | BF646730 |
Internal Acc. | NF077C12EC1F1097 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional nitrilase/nitrile hydratase NIT4B OS=Nicotiana tabacum E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4A OS=Nicotiana tabacum E-value=0; Bifunctional nitrilase/nitrile hydratase NIT4 OS=Arabidopsis thaliana E-value=5e-94; Bifunctional nitrilase/nitrile hydratase NIT4 OS=Oryza sativa subsp. japonica E-value=2e-91; Nitrilase 3 OS=Arabidopsis thaliana E-value=2e-78; |
Length | 641 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CACTTGTAACAACCACTCCAACCATCAATGACGGACCACTCATCTCCGAAGTTGACATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832290 |
Trichome-related Gene from Literature | N/A |